Genetic diversity of Potato virus M (PVM) in the major potato growing region in the Indo-Gangetic plain and characterization of a distinct strain of PVM occurring in India.

Potato virus M (PVM) is one of the most prevalent viruses infecting potatoes worldwide, showing a wide range of diversity in their populations; however, the diversity and genome information of PVM occurring in India is hardly known. The present study serologically detected the PVM in 22.8% of leaf samples collected from the potato fields, generated 13 coat protein (CP) genes and one complete genome sequence for the isolates from India, and identified four differential hosts confirming PVM-Del-144 as a distinct strain of PVM occurring in India. The phylogenetic analyses conducted based on the CP gene sequences (14 from India and 176 from other countries) suggested the existence of three evolutionary divergent lineages (PVM-o, PVM-d, and a new divergent group) in the PVM population, where isolates from India belong to only two clusters (PVM-o and PVM-d) within four sub-clusters. High levels of nucleotide diversity (0.124) and genetic distance (0.142) recorded among the isolates from India may be due to the deviation from the neutral evolution and experiencing population expansion in the past. The complete genome of the isolate Del-144 (KJ194171; 8,526 nucleotides) shared 92.2-93.9% nt sequence identity with the population of PVM-o, whereas it shared only 70.2-72.1% identity with PVM-d. In the phylogenetic analyses, Del-144 clustered with the isolates of PVM-o; however, it formed a separate branch away from all other isolates, indicating the diversity of the strain. Overall, this study revealed the diversity of the isolates of PVM from India and reported the first complete genome sequence of a distinct strain of PVM occurring in India.

Accelerated Long-Fragment Circular PCR for Genetic Manipulation of Plant Viruses in Unveiling Functional Genomics.

Molecular cloning, a crucial prerequisite for engineering plasmid constructs intended for functional genomic studies, relies on successful restriction and ligation processes. However, the lack of unique restriction sites often hinders construct preparation, necessitating multiple modifications. Moreover, achieving the successful ligation of large plasmid constructs is frequently challenging. To address these limitations, we present a novel PCR strategy in this study, termed 'long-fragment circular-efficient PCR' (LC-PCR). This technique involves one or two rounds of PCR with an additional third-long primer that complements both ends of the newly synthesized strand of a plasmid construct. This results in self-circularization with a nick-gap in each newly formed strand. The LC-PCR technique was successfully employed to insert a partial sequence (210 nucleotides) of the phytoene desaturase gene from Nicotiana benthamiana and a full capsid protein gene (770 nucleotides) of a begomovirus (tomato leaf curl New Delhi virus) into a 16.4 kb infectious construct of a tobamovirus, cucumber green mottle mosaic virus (CGMMV), cloned in pCambia. This was done to develop the virus-induced gene silencing vector (VIGS) and an expression vector for a foreign protein in plants, respectively. Furthermore, the LC-PCR could be applied for the deletion of a large region (replicase enzyme) and the substitution of a single amino acid in the CGMMV genome. Various in planta assays of these constructs validate their biological functionality, highlighting the utility of the LC-PCR technique in deciphering plant-virus functional genomics. The LC-PCR is not only suitable for modifying plant viral genomes but also applicable to a wide range of plant, animal, and human gene engineering under in-vitro conditions. Additionally, the LC-PCR technique provides an alternative to expensive kits, enabling quick introduction of modifications in any part of the nucleotide within a couple of days. Thus, the LC-PCR proves to be a suitable 'all in one' technique for modifying large plasmid constructs through site-directed gene insertion, deletion, and mutation, eliminating the need for restriction and ligation.

Microbial Exudates as Biostimulants: Role in Plant Growth Promotion and Stress Mitigation.

Microbes hold immense potential, based on the fact that they are widely acknowledged for their role in mitigating the detrimental impacts of chemical fertilizers and pesticides, which were extensively employed during the Green Revolution era. The consequence of this extensive use has been the degradation of agricultural land, soil health and fertility deterioration, and a decline in crop quality. Despite the existence of environmentally friendly and sustainable alternatives, microbial bioinoculants encounter numerous challenges in real-world agricultural settings. These challenges include harsh environmental conditions like unfavorable soil pH, temperature extremes, and nutrient imbalances, as well as stiff competition with native microbial species and host plant specificity. Moreover, obstacles spanning from large-scale production to commercialization persist. Therefore, substantial efforts are underway to identify superior solutions that can foster a sustainable and eco-conscious agricultural system. In this context, attention has shifted towards the utilization of cell-free microbial exudates as opposed to traditional microbial inoculants. Microbial exudates refer to the diverse array of cellular metabolites secreted by microbial cells. These metabolites enclose a wide range of chemical compounds, including sugars, organic acids, amino acids, peptides, siderophores, volatiles, and more. The composition and function of these compounds in exudates can vary considerably, depending on the specific microbial strains and prevailing environmental conditions. Remarkably, they possess the capability to modulate and influence various plant physiological processes, thereby inducing tolerance to both biotic and abiotic stresses. Furthermore, these exudates facilitate plant growth and aid in the remediation of environmental pollutants such as chemicals and heavy metals in agroecosystems. Much like live microbes, when applied, these exudates actively participate in the phyllosphere and rhizosphere, engaging in continuous interactions with plants and plant-associated microbes. Consequently, they play a pivotal role in reshaping the microbiome. The biostimulant properties exhibited by these exudates position them as promising biological components for fostering cleaner and more sustainable agricultural systems.

Exigency of Plant-Based Vaccine against COVID-19 Emergence as Pandemic Preparedness.

After two years since the declaration of COVID-19 as a pandemic by the World Health Organization (WHO), more than six million deaths have occurred due to SARS-CoV-2, leading to an unprecedented disruption of the global economy. Fortunately, within a year, a wide range of vaccines, including pathogen-based inactivated and live-attenuated vaccines, replicating and non-replicating vector-based vaccines, nucleic acid (DNA and mRNA)-based vaccines, and protein-based subunit and virus-like particle (VLP)-based vaccines, have been developed to mitigate the severe impacts of the COVID-19 pandemic. These vaccines have proven highly effective in reducing the severity of illness and preventing deaths. However, the availability and supply of COVID-19 vaccines have become an issue due to the prioritization of vaccine distribution in most countries. Additionally, as the virus continues to mutate and spread, questions have arisen regarding the effectiveness of vaccines against new strains of SARS-CoV-2 that can evade host immunity. The urgent need for booster doses to enhance immunity has been recognized. The scarcity of "safe and effective" vaccines has exacerbated global inequalities in terms of vaccine coverage. The development of COVID-19 vaccines has fallen short of the expectations set forth in 2020 and 2021. Furthermore, the equitable distribution of vaccines at the global and national levels remains a challenge, particularly in developing countries. In such circumstances, the exigency of plant virus-based vaccines has become apparent as a means to overcome supply shortages through fast manufacturing processes and to enable quick and convenient distribution to millions of people without the reliance on a cold chain system. Moreover, plant virus-based vaccines have demonstrated both safety and efficacy in eliciting robust cellular immunogenicity against COVID-19 pathogens. This review aims to shed light on the advantages and disadvantages of different types of vaccines developed against SARS-CoV-2 and provide an update on the current status of plant-based vaccines in the fight against the COVID-19 pandemic.

Development of a multiplex RT-RPA assay for simultaneous detection of three viruses in cucurbits.

Begomoviruses and criniviruses, vectored by whiteflies (Bemisia tabaci), are important threats to crops worldwide. In recent years, the spread of cucurbit leaf crumple virus (CuLCrV), cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) on cucurbit crops has been reported to cause devastating crop losses in many regions of the world. In this study, a multiplex recombinase polymerase amplification (RPA) assay, an isothermal technique for rapid and simultaneous detection of DNA and RNA viruses CuLCrV, CYSDV and CCYV was developed. Highly specific and sensitive multiplex RPA primers for the coat protein region of these viruses were created and evaluated. The sensitivity of the multiplex RPA assay was examined using serially diluted plasmid containing the target regions. The results demonstrated that multiplex RPA primers have high sensitivity with a detection limit of a single copy of the viruses. The multiplex RPA primers were specific to the target as indicated by testing against other begomoviruses, potyviruses and an ilarvirus, and no nonspecific amplifications were noted. The primers simultaneously detected mixed infection of CCYV, CYSDV and CuLCrV in watermelon and squash crude extracts. This study is the first report of a multiplex RPA assay for simultaneous detection of mixed infection of DNA and RNA plant viruses.

Delivery of progeny virus from the infectious clone of cucumber green mottle mosaic virus and quantification of the viral load in different host plants.

Cucumber green mottle mosaic virus (CGMMV, genus Tobamovirus) is a widely occurring tobamovirus in cucurbits. The genome of CGMMV has been used previously for the expression of foreign genes in the plant. High throughput delivery and high viral titer are important requirements of foreign protein expression in plant through virus genome-based vector, in this study, Agrobacterium containing infectious construct of CGMMV was infiltrated through syringe, vacuum and high-speed spray to N. benthamiana, cucumber and bottle gourd leaves. The success rate of systemic infection of CGMMV agro-construct through all three methods was higher (80-100%) in N. benthamiana compared to the cucurbits (40-73.3%). To determine the high-throughput delivery of CGMMV in the plant system, four delivery methods viz. rubbing, syringe infiltration, vacuum infiltration and high-speed spray using the progeny virus derived through CGMMV agro-construct were compared in the three different plant species. Based on the rate of systemic infection and time required to perform delivery by different methods, vacuum infiltration was found most efficient for the high-throughput delivery of CGMMV. The quantification of CGMMV through qPCR revealed that CGMMV load varied considerably in leaf and fruit tissues depending with the time of infection. Immediately after expression of symptoms, a high load of CGMMV (~ 1 µg/100 mg of tissues) was noticed in young leaves of N. benthamiana and cucumber. In bottle gourd leaves, the CGMMV load was far low compared to N. benthamiana and cucumber plants. In the fruit tissues of cucumber and bottle gourd higher virus load was observed in mature fruit but not in immature fruit. The findings of the present study will serve as an important base line information to produce foreign protein through CGMMV genome-vector. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-023-03630-y.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA.

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

Genomic properties of allamanda leaf mottle distortion virus, a new begomovirus from golden trumpet (Allamanda cathartica) in India.

Golden trumpet (Allamanda cathartica) plants were observed to exhibit mottling and distortion symptoms on leaves. The genome of an associated begomovirus (Al-K1) was amplified by rolling-circle amplification, cloned, and sequenced. The viral genome consisted of two circular ssDNA molecules, and the organization of the ORFs was similar to those of DNA-A and DNA-B components of bipartite begomoviruses. The size of DNA-A (KC202818) and DNA-B (MG969497) of the begomovirus was 2772 and 2690 nucleotides, respectively. Sequence analysis revealed that the DNA-A and DNA-B components shared the highest sequence identity with duranta leaf curl virus (MN537564, 87.8%) and cotton leaf curl Alabad virus (MH760452, 81.0%), respectively. Interestingly, the Al-K1 isolate shared significantly less nucleotide sequence identity with allamanda leaf curl virus (EF602306, 71.6%), the only monopartite begomovirus reported previously in golden trumpet from China. Al-K1 shared less than 91% sequence identity with other begomoviruses, and hence, according to the latest ICTV guidelines for species demarcation of begomoviruses, Al-K1 is proposed to be a member of a new species, and we propose the name "allamanda leaf mottle distortion virus" (AllLMoDV-[IN-Al_K1-12]) for this virus. AllLMoDV was detected in various golden trumpet samples from different locations by PCR with specific primers based on the genome sequence determined in this study. Our study provides evidence of the occurrence of a new bipartite begomovirus in a perennial ornamental plant in India.

Omics Insight on Fusarium Head Blight of Wheat for Translational Research Perspective.

In the scenario of global warming and climate change, an outbreak of new pests and pathogens has become a serious concern owing to the rapid emergence of arms races, their epidemic infection, and the ability to break down host resistance, etc. Fusarium head blight (FHB) is one such evidence that depredates major cereals throughout the world. The symptomatological perplexity and aetiological complexity make this disease very severe, engendering significant losses in the yield. Apart from qualitative and quantitative losses, mycotoxin production solemnly deteriorates the grain quality in addition to life endangerment of humans and animals after consumption of toxified grains above the permissible limit. To minimize this risk, we must be very strategic in designing sustainable management practices constituting cultural, biological, chemical, and host resistance approaches. Even though genetic resistance is the most effective and environmentally safe strategy, a huge genetic variation and unstable resistance response limit the holistic deployment of resistance genes in FHB management. Thus, the focus must shift towards the editing of susceptible (S) host proteins that are soft targets of newly evolving effector molecules, which ultimately could be exploited to repress the disease development process. Hence, we must understand the pathological, biochemical, and molecular insight of disease development in a nutshell. In the present time, the availability of functional genomics, proteomics, and metabolomics information on host-pathogen interaction in FHB have constructed various networks which helped in understanding the pathogenesis and coherent host response(s). So now translation of this information for designing of host defense in the form of desirable resistant variety/genotype is the next step. The insights collected and presented in this review will be aiding in the understanding of the disease and apprise a solution to the multi-faceted problems which are related to FHB resistance in wheat and other cereals to ensure global food safety and food security.

Complete genome sequence and phylogenetic relationships of tobacco streak virus causing groundnut stem necrosis disease in India.

Tobacco streak virus (TSV, genus Ilarvirus family Bromoviridae) is known to cause stem necrosis disease (SND) in groundnut (Arachis hypogaea) since 2000 in Southern India. The TSV isolate infecting groundnut so far has not been characterized based on the complete genome sequence. In this study, TSV was isolated from a naturally infecting groundnut plant in Kadiri, the hot-spot of the SND in southern India. During the Kharif season of 2014, groundnut plants in an experimental field were affected with chlorosis and necrosis in leaf, stem and buds. The cent percent of the 48 samples with these symptoms collected from the field tested positive for TSV in ELISA samples in this context. One isolate, GN-Kad was established from a single lesion on cowpea cv. C-152 through successive sap inoculation. Cloning and sequencing of coat protein gene (717 nucleotides) of the isolate showed high sequence identity (98-99%) with the TSV isolates reported from different crops in India. The isolate produced local necrotic rings or veinal necrosis following sap inoculation to cowpea (cultivars C-152, Pusa Komal, Pusa Sukomal and Krishi Kanchan), French bean and sunflower; whereas, it produced systemic chlorotic mottling symptoms in Nicotiana benthamiana. The three segments of the virus genome (RNA 1, RNA 2 and RNA 3) contained 3523, 2903 and 2232 nucleotides, respectively. The overall genome sequence (8639 nt) of the present isolate shared 77-99% of nucleotide sequence identity with that of the other seven isolates reported from Australia, India and USA. The GN-Kad shared very close phylogenetic relationship with the okra and pumpkin isolates reported from India. The present report is the first comprehensive study of the molecular characterization of TSV associated with the stem necrosis disease of groundnut.

Development of Soybean Yellow Mottle Mosaic Virus-Based Expression Vector for Heterologous Protein Expression in French Bean.

Plant virus-based vectors provide attractive and valuable tools for rapid production of recombinant protein in large quantities as they produce systemic infections in differentiated plant tissues. In the present study, we engineered the Soybean yellow mottle mosaic virus (SYMMV) as a gene expression vector which is a promising candidate for systemic expression of foreign proteins in French bean plants. Full virus vector strategy was exploited for insertion of foreign gene by inserting MCS through PCR in the circular pJET-SYMMV clone. To examine the ability of the SYMMV vector system, GFP gene was cloned after the start codon of coat protein (CP) so that its expression was driven by the SYMMV-CP subgenomic promoter. When in vitro run off SYMMV-GFP transcript was mechanically inoculated to French bean leaves, good level of GFP expression was observed through confocal microscopy up to 40 dpi. Expression of heterologous protein was also confirmed through ISEM, DAC-ELISA and RT-PCR with specific primers at 20 dpi. The recombinant SYMMV construct was stable in in vitro runoff transcript inoculated plants but the inserted GFP was lost in progeny virion inoculated plants. The system developed here will be useful for further studies of SYMMV gene functions and exploitation of SYMMV as a gene expression vector.

Natural infection of croton yellow vein mosaic virus and its cognate betasatellite in germplasm of different Crambe spp in India.

Crambe is an important crop grown worldwide for industrial oil and seed meal. Besides the fungal and bacterial diseases, the crop is reported to be infected by tobacco mosaic virus, beet western yellows virus and turnip mosaic virus under experimental condition. Till now, there was no report of natural infection of any begomovirus in this crop. In the present study, a leaf curl disease was observed in germplasm accessions of three species of Crambe (C. abyssinica, C. glabrata and C. hispanica). Based on the symptoms and presence of whitefly population in the field, begomovirus infection was suspected. Molecular characterization through RCA approach, indicated presence of croton yellow vein mosaic virus (CYVMV, KJ747958) and croton yellow vein mosaic betasatellite (CroYVMB, KM229762). Co-agroinoculation of partial dimeric construct of CYVMV with complete dimeric construct of CroYVMB, produced typical leaf curl symptoms in C. abyssinica, whereas, agroinoculation of partial dimeric construct of CYVMV alone could not produce symptoms in the same plant. In contrast, the CYVMV construct alone could produce symptom in Nicotiana benthamiana, a model host for plant virus studies. In N. benthamiana co-inoculation of CroYVMV with CYVMV construct develop more severe symptoms. However, neither the CYVMV construct alone nor the co-inoculation with CroYVMB produce any symptom in Arabidopsis thaliana even with different methods of inoculation. Inoculated Arabidopsis thaliana also did not yield any amplification of the virus as assessed through PCR and rolling circle amplification (RCA). Thus it confirmed that for successful infection in crambe, CYVMV requires betasatellite, while in N. benthamiana, it does not require betasatellite for symptom induction and in Arabidopsis thaliana CYVMV alone or in presence of betasatellite did not replicate and produce any symptom. This study constitutes the first confirmed record of natural infection of a begomovirus in crambe and further confirmed that cognate betasatellite of CYVMV has differential role in infectivity in different hosts.

A CGMMV genome-replicon vector with partial sequences of coat protein gene efficiently expresses GFP in Nicotiana benthamiana.

A highly infectious clone of Cucumber green mottle mosaic virus (CGMMV), a cucurbit-infecting tobamovirus was utilized for designing of gene expression vectors. Two versions of vector were examined for their efficacy in expressing the green fluorescent protein (GFP) in Nicotiana benthamiana. When the GFP gene was inserted at the stop codon of coat protein (CP) gene of the CGMMV genome without any read-through codon, systemic expression of GFP, as well as virion formation and systemic symptoms expression were obtained in N. benthamiana. The qRT-PCR analysis showed 23 fold increase of GFP over actin at 10days post inoculation (dpi), which increased to 45 fold at 14dpi and thereafter the GFP expression was significantly declined. Further, we show that when the most of the CP sequence is deleted retaining only the first 105 nucleotides, the shortened vector containing GFP in frame of original CP open reading frame (ORF) resulted in 234 fold increase of GFP expression over actin at 5dpi in N. benthamiana without the formation of virions and disease symptoms. Our study demonstrated that a simple manipulation of CP gene in the CGMMV genome while preserving the translational frame of CP resulted in developing a virus-free, rapid and efficient foreign protein expression system in the plant. The CGMMV based vectors developed in this study may be potentially useful for the production of edible vaccines in cucurbits.

Genome characterization, infectivity assays of in vitro and in vivo infectious transcripts of soybean yellow mottle mosaic virus from India reveals a novel short mild genotype.

Nucleotide sequence of a distinct soybean yellow mottle mosaic virusisolate from Vignaradiata (mungbean isolate, SYMMV-Mb) from India was determined and compared with othermembers of the family Tombusviridae. The complete monopartite single-stranded RNA genome of SYMMV-Mb consisted of 3974nt with six putative open reading frames and includes 5' and 3' untranslated regions of 35 and 254nt, respectively. SYMMV-Mb genome shared 75% nt sequence identity at complete genome level and 67-92% identity at all ORFs level with SYMMV Korean and USA isolates (soybean isolates) followed by CPMoV, whereas it shared very low identity with other tombusviridae members (5-41%). A full-length infectious cDNA clone of the SYMMV-Mb placed under the control of the T7 RNA polymerase and the CaMV35S promoters was generated and French bean plants on mechanical inoculation with in vitro RNA transcripts, p35SSYMMV-O4 plasmid and agroinoculation with p35SSYMMV-O4 showed symptoms typical of SYMMV-Mb infection. The infection was confirmed by DAC-ELISA, ISEM, RT-PCR and mechanical transmission to new plant species. Further testing of different plant species with agroinoculation of p35SSYMMV-O4 showed delay in symptoms but indistinguishable from mechanical sap inoculation and the infection was confirmed by DAC-ELISA, RT-PCR and mechanical transmission to new plants. The system developed here will be useful for further studies on pathogenecity, viral gene functions, plant-virus-vector interactions of SYMMV-Mb and to utilize it as a gene expression and silencing vector.

Agroinfection of tobacco by croton yellow vein mosaic virus and designing of a replicon vector for expression of foreign gene in plant.

Croton yellow vein mosaic virus (CYVMV, genus Begomovirus family Geminiviridae) is a proliferating begomovirus in the Indian sub-continent. The infectious constructs in binary vector was developed against the CYVMV genome and its associated betasatellite. Agroinoculation of the genomic construct of CYVMV produced leaf curl symptoms alone in three species of tobacco, Nicotiana tabacum, N. benthamiana and N. glutinosa. Co-inoculation of betasatellite enhanced the severity of the disease and reduced the incubation time. Based on the infectious clone, a replicon vector pCro, with only the ability to replicate inside the plant was developed. In pCro vector, CP and V2 ORFs from genome of CYVMV was deleted, which resulted localised replication of the molecule with no visible symptoms. Besides the partial CYVMV genome, pCro also has a cassette containing a double 35S promoter, multiple cloning sites and a NOS terminator to overexpress any foreign protein in plant. Episomal release of the replicon from the binary vector backbone after agroinoculation was detected by PCR. A GFP gene was cloned in pCro vector (pCro-GFP) and agroinoculated to N. tabacum resulted in localized expression of GFP at 5 dpi. The CYVMV replicon vector will be a useful tool for studying functional genomics, vaccine expression and gene silencing in plant.